ID: 958951077_958951086

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 958951077 958951086
Species Human (GRCh38) Human (GRCh38)
Location 3:100416874-100416896 3:100416887-100416909
Sequence CCCTCCCCTTTCCCCTAACCCAG CCTAACCCAGCAACAGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 15, 3: 203, 4: 1803} {0: 1, 1: 3, 2: 37, 3: 642, 4: 4235}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!