ID: 959026302_959026304

View in Genome Browser

Spacer: -9

Left Crispr Right Crispr
Crispr ID 959026302 959026304
Species Human (GRCh38) Human (GRCh38)
Location 3:101243674-101243696 3:101243688-101243710
Sequence CCTTCTGTGGGCCAAGCCACACT AGCCACACTAACCATCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 2, 3: 20, 4: 255} {0: 1, 1: 0, 2: 1, 3: 20, 4: 156}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!