ID: 959039525_959039535

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 959039525 959039535
Species Human (GRCh38) Human (GRCh38)
Location 3:101405156-101405178 3:101405201-101405223
Sequence CCTCCTGAAGGAAGCAGAGTACA AAATACTATGCTGGTATCCATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 418} {0: 3, 1: 18, 2: 19, 3: 24, 4: 195}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!