ID: 959056947_959056953

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 959056947 959056953
Species Human (GRCh38) Human (GRCh38)
Location 3:101576509-101576531 3:101576533-101576555
Sequence CCACGGTGCGGCCACGGCGGCCA TGGTCTTGGTGTGCTGGCCTCGG
Strand - +
Off-target summary {0: 2, 1: 0, 2: 1, 3: 13, 4: 91} {0: 5, 1: 2, 2: 5, 3: 23, 4: 406}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!