ID: 959084352_959084354

View in Genome Browser

Spacer: -3

Left Crispr Right Crispr
Crispr ID 959084352 959084354
Species Human (GRCh38) Human (GRCh38)
Location 3:101835236-101835258 3:101835256-101835278
Sequence CCAGGTTTGTTTAACTTCAGAAC AACCCCATGCTTTTAATCAAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 33, 4: 294} {0: 1, 1: 0, 2: 1, 3: 19, 4: 135}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!