ID: 959085770_959085786

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 959085770 959085786
Species Human (GRCh38) Human (GRCh38)
Location 3:101849535-101849557 3:101849582-101849604
Sequence CCGCCGACAGCTCCCTGAGCCAG AGCCGGTGGCGCAGGTGTCGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 37, 4: 215} {0: 1, 1: 0, 2: 0, 3: 6, 4: 99}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!