ID: 959110359_959110365

View in Genome Browser

Spacer: 6

Left Crispr Right Crispr
Crispr ID 959110359 959110365
Species Human (GRCh38) Human (GRCh38)
Location 3:102115643-102115665 3:102115672-102115694
Sequence CCCTGCCTCATCCATTTATCCTG GAAAGCTGCCTAACTAATTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 335} {0: 1, 1: 0, 2: 0, 3: 9, 4: 110}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!