ID: 959126059_959126066

View in Genome Browser

Spacer: 27

Left Crispr Right Crispr
Crispr ID 959126059 959126066
Species Human (GRCh38) Human (GRCh38)
Location 3:102291325-102291347 3:102291375-102291397
Sequence CCCACAATCACTGTGCTCTCCTT TAATATGTGGCCACTGCCACAGG
Strand - +
Off-target summary {0: 4, 1: 34, 2: 84, 3: 158, 4: 457} {0: 1, 1: 0, 2: 1, 3: 9, 4: 125}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!