ID: 959666725_959666730

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 959666725 959666730
Species Human (GRCh38) Human (GRCh38)
Location 3:108931277-108931299 3:108931301-108931323
Sequence CCCTTAGAACATTTGATATTTTA TTTTAGGTACAGTACATGGGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 2, 3: 51, 4: 576} {0: 1, 1: 0, 2: 0, 3: 11, 4: 117}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!