ID: 959679132_959679135

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 959679132 959679135
Species Human (GRCh38) Human (GRCh38)
Location 3:109072662-109072684 3:109072705-109072727
Sequence CCGTCCACTTAGGAAAGGGAGAT GGATATCTTCAGAAGATGAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 25, 4: 189} {0: 1, 1: 0, 2: 3, 3: 14, 4: 284}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!