ID: 959833662_959833669

View in Genome Browser

Spacer: 15

Left Crispr Right Crispr
Crispr ID 959833662 959833669
Species Human (GRCh38) Human (GRCh38)
Location 3:110893272-110893294 3:110893310-110893332
Sequence CCTTCCTCCTTCTTTTTGTCCTT TGCCTATACTTTTTGAGGAGTGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 21, 3: 437, 4: 3536} {0: 1, 1: 0, 2: 0, 3: 12, 4: 120}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!