ID: 959849824_959849831

View in Genome Browser

Spacer: -10

Left Crispr Right Crispr
Crispr ID 959849824 959849831
Species Human (GRCh38) Human (GRCh38)
Location 3:111072388-111072410 3:111072401-111072423
Sequence CCTCCCCCGCGGCCGCGCGGGTC CGCGCGGGTCGCCGTGCGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 4, 3: 35, 4: 326} {0: 1, 1: 0, 2: 0, 3: 2, 4: 49}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!