ID: 959876847_959876851

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 959876847 959876851
Species Human (GRCh38) Human (GRCh38)
Location 3:111393162-111393184 3:111393189-111393211
Sequence CCTCAGTGTGCATTGACCTGTCC ATTTGCATGTAATTGAAAGTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 22, 4: 156} {0: 26, 1: 115, 2: 189, 3: 287, 4: 465}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!