ID: 959889833_959889838

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 959889833 959889838
Species Human (GRCh38) Human (GRCh38)
Location 3:111542127-111542149 3:111542149-111542171
Sequence CCCAGGCGTGTGTGGTAGAGTTC CGGGTTTTTTAGCACGAAGTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 74} {0: 1, 1: 0, 2: 0, 3: 0, 4: 26}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!