ID: 959919452_959919461

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959919452 959919461
Species Human (GRCh38) Human (GRCh38)
Location 3:111854921-111854943 3:111854974-111854996
Sequence CCTTGGGGAGAGGCAAGAATGCT GTCAAGGTTGTTTTGACCCAGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 3, 3: 35, 4: 240} {0: 2, 1: 11, 2: 21, 3: 53, 4: 233}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!