ID: 959923917_959923921

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 959923917 959923921
Species Human (GRCh38) Human (GRCh38)
Location 3:111900511-111900533 3:111900564-111900586
Sequence CCTGTTGATGGAGCGGTTAGAAC TCTTATATGGGCATGGTTTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 11, 3: 90, 4: 239} {0: 25, 1: 61, 2: 188, 3: 315, 4: 547}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!