ID: 959926525_959926527

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 959926525 959926527
Species Human (GRCh38) Human (GRCh38)
Location 3:111927772-111927794 3:111927812-111927834
Sequence CCTTGAACCATCTGTTTATCAAG TGATAAAATGATTTTTTAATTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 21, 4: 2547} {0: 1, 1: 0, 2: 5, 3: 107, 4: 950}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!