ID: 959956530_959956536

View in Genome Browser

Spacer: 21

Left Crispr Right Crispr
Crispr ID 959956530 959956536
Species Human (GRCh38) Human (GRCh38)
Location 3:112244724-112244746 3:112244768-112244790
Sequence CCAACTTCCAGAATTTATGTTTC TGTATCCACAGATGGAATTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 59, 4: 499} {0: 1, 1: 0, 2: 1, 3: 16, 4: 185}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!