ID: 959963885_959963891

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 959963885 959963891
Species Human (GRCh38) Human (GRCh38)
Location 3:112332571-112332593 3:112332608-112332630
Sequence CCACAGAGCGAGACTCCGTCTCA GAGAAGAAGGAGAAGGAGAAGGG
Strand - +
Off-target summary {0: 452, 1: 1147, 2: 2211, 3: 2450, 4: 2239} {0: 3, 1: 38, 2: 202, 3: 1151, 4: 5083}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!