ID: 960051431_960051434

View in Genome Browser

Spacer: 9

Left Crispr Right Crispr
Crispr ID 960051431 960051434
Species Human (GRCh38) Human (GRCh38)
Location 3:113242409-113242431 3:113242441-113242463
Sequence CCTCCAGTGCTGGAGCAGGGAGA GTGTTTTAGCAGAAGCTCTGTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 42, 4: 333} {0: 1, 1: 0, 2: 1, 3: 17, 4: 231}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!