ID: 960094070_960094072

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 960094070 960094072
Species Human (GRCh38) Human (GRCh38)
Location 3:113671221-113671243 3:113671236-113671258
Sequence CCTCTTTATGGCAAATGGGCAAA TGGGCAAATGAGGCCTTTCTAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 161} {0: 1, 1: 0, 2: 0, 3: 26, 4: 188}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!