ID: 960094688_960094693

View in Genome Browser

Spacer: -8

Left Crispr Right Crispr
Crispr ID 960094688 960094693
Species Human (GRCh38) Human (GRCh38)
Location 3:113677910-113677932 3:113677925-113677947
Sequence CCAAACATGACAAATGAGAGGTC GAGAGGTCTGGGTAGGGCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 171} {0: 1, 1: 0, 2: 6, 3: 36, 4: 378}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!