ID: 960206822_960206825

View in Genome Browser

Spacer: 24

Left Crispr Right Crispr
Crispr ID 960206822 960206825
Species Human (GRCh38) Human (GRCh38)
Location 3:114912027-114912049 3:114912074-114912096
Sequence CCTTGTTCCATATAAGTGAACAT CAAGAAAAACCTTGTAAACCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 40, 4: 397} {0: 1, 1: 0, 2: 0, 3: 24, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!