ID: 960215290_960215293

View in Genome Browser

Spacer: 30

Left Crispr Right Crispr
Crispr ID 960215290 960215293
Species Human (GRCh38) Human (GRCh38)
Location 3:115026754-115026776 3:115026807-115026829
Sequence CCTTTCATCACCTGTGTATATTG TTTTATATGAAAAACATTGCGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 13, 4: 216} {0: 1, 1: 0, 2: 3, 3: 55, 4: 506}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!