ID: 960294359_960294374

View in Genome Browser

Spacer: 29

Left Crispr Right Crispr
Crispr ID 960294359 960294374
Species Human (GRCh38) Human (GRCh38)
Location 3:115925073-115925095 3:115925125-115925147
Sequence CCTGGGTTTCCTTCCAAGTCCAC TGTGTGTGTTCCTAGGCCTGGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 203} {0: 1, 1: 0, 2: 3, 3: 34, 4: 337}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!