ID: 960298188_960298194

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 960298188 960298194
Species Human (GRCh38) Human (GRCh38)
Location 3:115968999-115969021 3:115969044-115969066
Sequence CCTACAATCACTGAGCTCACCTT GACCCACACAACCACTGTCAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 8, 3: 53, 4: 318} {0: 1, 1: 0, 2: 0, 3: 5, 4: 127}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!