ID: 960327695_960327698

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 960327695 960327698
Species Human (GRCh38) Human (GRCh38)
Location 3:116317319-116317341 3:116317358-116317380
Sequence CCGGACACAATACAAAGAGAGCC TTTTTTTTTTTTTTTTGAGACGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 112} {0: 83672, 1: 60776, 2: 74199, 3: 114646, 4: 163091}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!