ID: 960333874_960333882

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960333874 960333882
Species Human (GRCh38) Human (GRCh38)
Location 3:116392789-116392811 3:116392840-116392862
Sequence CCAGGACTCAGCCAGACTTGAGC CGGGATGACAAGCTACAGAGAGG
Strand - +
Off-target summary {0: 4, 1: 15, 2: 60, 3: 152, 4: 391} {0: 1, 1: 1, 2: 18, 3: 136, 4: 353}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!