ID: 960353412_960353413

View in Genome Browser

Spacer: -4

Left Crispr Right Crispr
Crispr ID 960353412 960353413
Species Human (GRCh38) Human (GRCh38)
Location 3:116621339-116621361 3:116621358-116621380
Sequence CCTGGCAGTTAAAAAAAAAACTC ACTCTTATGCCATTAACACAAGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 4, 3: 61, 4: 763} {0: 1, 1: 0, 2: 2, 3: 9, 4: 130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!