ID: 960392158_960392163

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 960392158 960392163
Species Human (GRCh38) Human (GRCh38)
Location 3:117090700-117090722 3:117090722-117090744
Sequence CCTCAAGTGACGGTCAGGTTTTC CATTAAAGTGGGAAGGTGGAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 73} {0: 1, 1: 0, 2: 1, 3: 29, 4: 302}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!