ID: 960574006_960574014

View in Genome Browser

Spacer: 23

Left Crispr Right Crispr
Crispr ID 960574006 960574014
Species Human (GRCh38) Human (GRCh38)
Location 3:119211567-119211589 3:119211613-119211635
Sequence CCACAAGGAGGTCACAAATGAGA CGGGAGACAGAAGTAGTGGAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 18, 4: 235} {0: 1, 1: 0, 2: 1, 3: 24, 4: 316}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!