|
Left Crispr |
Right Crispr |
Crispr ID |
960614392 |
960614397 |
Species |
Human (GRCh38) |
Human (GRCh38) |
Location |
3:119583651-119583673
|
3:119583666-119583688
|
Sequence |
CCTGTAATCCCAACACTGTGAAA |
CTGTGAAAGGCCAAGGTGAGAGG |
Strand |
- |
+ |
Off-target summary |
{0: 3, 1: 119, 2: 3544, 3: 51975, 4: 351913} |
{0: 2, 1: 5, 2: 283, 3: 4156, 4: 34696} |
Status |
Not started |
Paired Off-Target Sites
Note: the row highlighted in blue is the original CRISPR pair
Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.
Spacer |
Left Crispr |
Right Crispr |
|
Location |
Sequence |
Mismatches |
Strand |
Location |
Sequence |
Mismatches |
Strand |
No off target data available for this pair!
|