ID: 960637819_960637828

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960637819 960637828
Species Human (GRCh38) Human (GRCh38)
Location 3:119801488-119801510 3:119801539-119801561
Sequence CCTGCCCAGAGGGCAACATTCTG GGGAGCAGGACTGCAGCTGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 3, 3: 15, 4: 177} {0: 1, 1: 0, 2: 2, 3: 45, 4: 425}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!