ID: 960672442_960672449

View in Genome Browser

Spacer: 12

Left Crispr Right Crispr
Crispr ID 960672442 960672449
Species Human (GRCh38) Human (GRCh38)
Location 3:120166410-120166432 3:120166445-120166467
Sequence CCATAATGGTGGAAAGACACCAT GTGTAGGGGTGGCTCTGAGCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 131} {0: 1, 1: 0, 2: 0, 3: 20, 4: 259}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!