ID: 960699064_960699065

View in Genome Browser

Spacer: -1

Left Crispr Right Crispr
Crispr ID 960699064 960699065
Species Human (GRCh38) Human (GRCh38)
Location 3:120423461-120423483 3:120423483-120423505
Sequence CCTGTTCATATAGGGCTGAAAAT TCATCTCACAAAGATCTGTGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 116} {0: 1, 1: 0, 2: 1, 3: 24, 4: 210}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!