ID: 960760722_960760729

View in Genome Browser

Spacer: 17

Left Crispr Right Crispr
Crispr ID 960760722 960760729
Species Human (GRCh38) Human (GRCh38)
Location 3:121071784-121071806 3:121071824-121071846
Sequence CCTTCTTAAGGTTAATTCCCCAG TTTATCTGAGTTATCATCAGGGG
Strand - +
Off-target summary {0: 1, 1: 4, 2: 7, 3: 13, 4: 120} {0: 1, 1: 0, 2: 0, 3: 18, 4: 190}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!