ID: 960789040_960789041

View in Genome Browser

Spacer: 8

Left Crispr Right Crispr
Crispr ID 960789040 960789041
Species Human (GRCh38) Human (GRCh38)
Location 3:121406371-121406393 3:121406402-121406424
Sequence CCTTGAGACATTATCAGTCTAAG CTTTCTCTGCATGATGTAAAAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 108} {0: 1, 1: 0, 2: 0, 3: 17, 4: 292}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!