ID: 960819878_960819882

View in Genome Browser

Spacer: 19

Left Crispr Right Crispr
Crispr ID 960819878 960819882
Species Human (GRCh38) Human (GRCh38)
Location 3:121718129-121718151 3:121718171-121718193
Sequence CCCTAGATCTAAAATGGCAAAGG AGTGCAATGTATGCTCCATGAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 175} {0: 1, 1: 0, 2: 10, 3: 36, 4: 351}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!