ID: 960846364_960846374

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960846364 960846374
Species Human (GRCh38) Human (GRCh38)
Location 3:122007714-122007736 3:122007765-122007787
Sequence CCTGGAGCACTCTTCCACATCAC CTAATTATGATTCGTGCCTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 152} {0: 1, 1: 0, 2: 0, 3: 2, 4: 77}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!