ID: 960886939_960886950

View in Genome Browser

Spacer: 28

Left Crispr Right Crispr
Crispr ID 960886939 960886950
Species Human (GRCh38) Human (GRCh38)
Location 3:122405616-122405638 3:122405667-122405689
Sequence CCTTCCTCAGTCTGCCTAATAGT TACTACCTCACGAATCACTCTGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 6, 3: 124, 4: 2867} {0: 1, 1: 0, 2: 1, 3: 3, 4: 39}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!