ID: 960889018_960889022

View in Genome Browser

Spacer: 16

Left Crispr Right Crispr
Crispr ID 960889018 960889022
Species Human (GRCh38) Human (GRCh38)
Location 3:122426664-122426686 3:122426703-122426725
Sequence CCACAAGAAAAAGGGAGCCACAT CCATAACTCTAATGTAAGTGCGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 0, 3: 21, 4: 216} {0: 1, 1: 0, 2: 0, 3: 7, 4: 89}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!