ID: 960907983_960907995

View in Genome Browser

Spacer: 10

Left Crispr Right Crispr
Crispr ID 960907983 960907995
Species Human (GRCh38) Human (GRCh38)
Location 3:122620748-122620770 3:122620781-122620803
Sequence CCCGAGGGGCCCTAGGGAGTGCC TGCTCCTCAGGAGGGCAGGATGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 141} {0: 1, 1: 0, 2: 2, 3: 39, 4: 499}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!