ID: 960915107_960915110

View in Genome Browser

Spacer: 4

Left Crispr Right Crispr
Crispr ID 960915107 960915110
Species Human (GRCh38) Human (GRCh38)
Location 3:122686954-122686976 3:122686981-122687003
Sequence CCCTTATCAGACCTTTTCATTAT TCTATTTACCCTCCATCTCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 284} {0: 1, 1: 0, 2: 1, 3: 28, 4: 567}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!