ID: 960969655_960969662

View in Genome Browser

Spacer: 20

Left Crispr Right Crispr
Crispr ID 960969655 960969662
Species Human (GRCh38) Human (GRCh38)
Location 3:123130437-123130459 3:123130480-123130502
Sequence CCCCAGGGCCTGCTCTGAGCTCT TCCGCAGCCGCCACAGCCCCAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 10, 3: 52, 4: 489} {0: 1, 1: 0, 2: 9, 3: 55, 4: 412}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!