ID: 960981533_960981537

View in Genome Browser

Spacer: 14

Left Crispr Right Crispr
Crispr ID 960981533 960981537
Species Human (GRCh38) Human (GRCh38)
Location 3:123232548-123232570 3:123232585-123232607
Sequence CCAAAAAAACAGTAAAGGGCCAG ACCTGTAATCCCACCACTTTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 33, 4: 312} {0: 615, 1: 80457, 2: 321136, 3: 243106, 4: 142130}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!