ID: 960983656_960983659

View in Genome Browser

Spacer: 3

Left Crispr Right Crispr
Crispr ID 960983656 960983659
Species Human (GRCh38) Human (GRCh38)
Location 3:123256578-123256600 3:123256604-123256626
Sequence CCTGGCCTTTCTTTTTTCTCTAT GAATTAGATGTGTCTCCATTGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 18, 3: 294, 4: 4604} {0: 1, 1: 0, 2: 1, 3: 10, 4: 147}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!