ID: 960987968_960987979

View in Genome Browser

Spacer: 13

Left Crispr Right Crispr
Crispr ID 960987968 960987979
Species Human (GRCh38) Human (GRCh38)
Location 3:123292698-123292720 3:123292734-123292756
Sequence CCCACGGGAGAAGGCTGGGGGTG ATCCCTGTGCTTCTTCTCACAGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 171} {0: 1, 1: 0, 2: 1, 3: 24, 4: 212}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!