ID: 961001990_961001999

View in Genome Browser

Spacer: 22

Left Crispr Right Crispr
Crispr ID 961001990 961001999
Species Human (GRCh38) Human (GRCh38)
Location 3:123380214-123380236 3:123380259-123380281
Sequence CCATCCATGTGATTATCAACCAC GTGGTGAACAGGCTTGAGTAGGG
Strand - +
Off-target summary {0: 1, 1: 0, 2: 1, 3: 12, 4: 139} {0: 1, 1: 0, 2: 1, 3: 19, 4: 180}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!