ID: 961012909_961012924

View in Genome Browser

Spacer: 11

Left Crispr Right Crispr
Crispr ID 961012909 961012924
Species Human (GRCh38) Human (GRCh38)
Location 3:123448122-123448144 3:123448156-123448178
Sequence CCGCCGCCGAGCCGCCGCCGCCG CGCCCGGGTGCTGCCCCCGCTGG
Strand - +
Off-target summary {0: 1, 1: 6, 2: 39, 3: 204, 4: 871} {0: 1, 1: 0, 2: 1, 3: 14, 4: 271}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!