ID: 961013416_961013428

View in Genome Browser

Spacer: 1

Left Crispr Right Crispr
Crispr ID 961013416 961013428
Species Human (GRCh38) Human (GRCh38)
Location 3:123449855-123449877 3:123449879-123449901
Sequence CCTCCGCCCCCGGCCTGGCCATG CCCCAGCCTCGGCGCCCCGCGGG
Strand - +
Off-target summary {0: 1, 1: 1, 2: 16, 3: 263, 4: 1977} {0: 1, 1: 0, 2: 4, 3: 40, 4: 357}
Status Not started

Paired Off-Target Sites

Note: the row highlighted in blue is the original CRISPR pair

Mismatch count: Left/right refers to the CRISPR the off target matched. Fwd/rev is the orientation of the match.

Spacer Left Crispr Right Crispr
Location Sequence Mismatches Strand Location Sequence Mismatches Strand
No off target data available for this pair!